25 ago. 2012

SORTEO 56

Se ha notado que la gente está de vacaciones, esta semana hemos tenido menos comentarios. Aún así la suerte es sólo para uno/a, y esta vez ha ganado el número 25 correspondiente a MONTSE MAS; ya tengo tu dirección por lo que vas a recibirlos en breve.


Para el sorteo de esta semana os propongo unos marcapáginas del año 1998, es una serie de 5 pero que no hace puzle.

















Este próximo fin de semana, 1 y 2 de septiembre se celebra la Feria REPLEGA en Monzón, es una de las más importantes en cuanto a coleccionismo, venda, exposición e intercambio.
En ella puedes encontrar de todo, todo lo que es coleccionable y a ella acuden coleccionistas de toda España e incluso algún que otro europeo.
Estos marcapáginas no son de la Feria Replega pero si de la Feria del Libro que también tiene lugar cada año en Monzón.
Espero que os guste. Si podéis o tenéis la oportunidad de llegaros hasta Monzón no os arrepentiréis.
Esta es la última semana que os queda para mandar el sobre franqueado (ver sorteo 54), ya nos han llegado bastantes y casi todos ya se han devuelto.

ESTE SORTEO LO HAREMOS Y PUBLICAREMOS EL DOMINGO DIA 2 CUANDO REGRESEMOS DE MONZÓN.


41 comentarios:

Anónimo dijo...

Pues como las últimas semanas, a este también me apunto!! Saludos, Bea Reyes

Anónimo dijo...

Hola,
Yo también me apunto.

Abrazos, Elly

Montserrat Manyer Bernia dijo...

Hola bon dia, jo també m'apunto
una abraçada

Raquel ♪ dijo...

No sabía que existiera tal feria. Gracias por la información.

¿Puedo apuntarme? si es así me apunto al sorteo.

Los marcapáginas me parecen muy llamativos y originales.

Besos

Anónimo dijo...

Hola a tothom!

Gràcies per la informació sobre la trobada de Monzón i pels punts d´aquesta setmana, que són molt i molt bonics! quines coloraines!

M´hi apunto, és clar!

Glòria de Cardedeu

Anónimo dijo...

Molt originals i com sempre esperem on va la sort.

Salutacions a tothom

Margarita de Manresa

Anónimo dijo...

Hola, a tod@s

Todavía no coleccionaba marcapáginas y, éstos, de la Feria del libro de Monzón no los tengo.
Saludos

Manel B.

Poetisa dijo...


Hola a tod@s, me tomé unas pequeñas vacaciones y al regresar me he encontrado con este maravilloso sorteo de marcapáginas que es poco usual y visto... al menos para mí. ¡¡¡Felicitaciones por la Feria!!!, espero que tod@s os encontreis bien y con ánimos para seguir coleccionando, ah, bienvenidos a algun@s nuevos amigos que no tenía el gusto de conocer.


Un abrazo,

M.Inmaculada V.C.(Córdoba)

Anónimo dijo...

Hola a tod@s
Aprovechando que las temperaturas nos dan un respiro, me apunto al último sorteo de Agosto.
Suerte a todos.
Javier ( Aranjuez)

Poetisa dijo...

Aprovechando que en breve será mi cumpleaños, pues estoy pensando que sería un lindo regalo, el poder conseguir este juego de marcapáginas. Mañana iré a correos a hacer las gestiones en breve espero os llegue...

Saludos, y suerte a tod@s.

M.Inmaculada V.C. (Córdoba)

Justa dijo...

Hola a todos y enhorabuena a Montse Mas:
Espero que lo paséis muy bien en Monzón y que hagáis muchos intercambios.......¡a más de uno nos va a dar una envidia.....!
Unha aperta

Justa

Esperança BCN dijo...

Quina enveixa poder anar a Monzon, peró...Fins aviat

Sonia Andrade Lee dijo...

Debemos aprovechar que hay muchos de vacaciones entonces para tener más suerte de ganar... :)

Tal vez esta semana tengamos la suerte de Montse Mas!

Gracias por la bienvenida Poetisa.

Saludos y MUCHA SUERTE a todos!

Un abrazo

Pepi Castellanos dijo...

Me gustan sobre todo por la variedad cromática que tienen... Espero tener suerte.
Saludos.
Pepi (Toledo)

JORDI I CARMEN dijo...

Hola a tothom.
Jo tambe mi apunto.
Estem a fora i si consegui algun de la setmana i el pode-ho guardar no tornare fin a la trobada del meu cunyat.
JORDI

Anónimo dijo...

Cuac Cuac Poetisa

¡¡¡¡Ya estamos aprovechando la vena sentimental del cumpleaños....!!!

¡Pues si es tu cumpleaños, te felicitamos, te pagas unos kilitos de pasteles para el personal y punto pelota!

Alazos. Pato

Eli Ramirez dijo...

Jo m'apunto també!!!

Anónimo dijo...

M'apunto al sorteig,
a reveure, espero que a Monzón.
Pere C.

mondopunt dijo...

Ya me tenías preocupada pato, hacia dias que no te metías con nadie...
Justa, felicidades, pero el rollo sentimental no cuela en este sorteo !!!
Montse

Anónimo dijo...

Quina sorpresa he tingut¡¡¡
estic molt contenta.
M'apunto també aquesta vegada si no es molt abusar.
Montse Mas

maribel dijo...

No en tinc cap. M'apunto.

Anónimo dijo...

Com sempre molt bonics, m'apunto, ja que no tinc cap.
Margarita - L'Hospitalet

Anónimo dijo...

Por fin llegaron las lluvias y ha cambiado un poco el tiempo unos dias mas como hoy, despues un poco de sol sin viento y tendremos !!!! robellons!!!!!!
Nos vemos en Monzón
LA BRUIXA DEL PUNT

Goretti dijo...

Pruebo suerte una vez más. Disfrutad del encuentro en Monzón.

Justa dijo...

Montse, creo que me has confundido con Poetisa.........Allá cada uno con sus cumpleaños, a mí me llega con el mío.
De todas formas, gracias por la felicitación, aunque sea con nueve meses de adelanto.
Unha aperta

Justa

Anónimo dijo...

Hola,
m'apunto de nou al sorteig.
Ens veiem a Monzon!

Cle

Anónimo dijo...

Hola, a ver si tengo suerte, ya que estamos de fiestas patronales aqui. saludos.MABEL.

Anónimo dijo...

Hola a todos.

Bruixa, a mi padre le encantaban los robellons (o níscalos, como se les conoce por aqui).

Le recuerdo limpiándolos de tierra bajo el grifo y era todo un ritual...

A mí nunca me habían llamado la atención y hace tiempo compré una bandeja y no pude con ellos, debido a su fuerte sabor (dicen que no hay mala materia prima, si- no mal cocinero)

Abrazos. Javier (Aranjuez)



mondopunt dijo...

Es verdad Justa me he equivocado, felicito a Poetisa. En cuanto a Javier decirle que los Rovellons de alta montaña (Queralbs)no son tan buenos como los de Girona, je,je,je; tienen más sabor y tienes razón si no te gustaron fué por el cocinero pués a la brasa con all i julivert, estan de muerte!!!
También guisados con ternera, y... con pato no los he probado nunca, no sé talvez....
Montse

Joan Maso d'Olot dijo...

Com sempre molt bonics i originals
salutacions

Anónimo dijo...

Hola Montse
¿Julivert normal, arrisat, o dá lo mismo?
De todas formas, tienen que seguir estando fuertes de co.ons, si encima le metes el all........

En cualquier caso, unas buenas fresas de postre para rematar( y digo fresas, no el freson gordo que se vende habitualmente)

Pato quiere que te diga que él tambien te quiere.

Saludos. Javier (Aranjuez)

Anónimo dijo...

Ya con fresquito me apunto al primer sorteo de septiembre que
es mi mes.
Suerte a todos.
Carmen

Anónimo dijo...

No es per copiar a ningú, però demà es el meu "cumple", per Sant Ramon.
A veure si com a regal em plouen aquests punts.
(No diré quans en faig).
Manel G.B.

Anónimo dijo...

Hola a tothom.

Per molts anys a aquests que fan anys.
Tot i que no es el meu aniversari, estaria bè que em toquesin.
Que vagi bè el Replega als que hi aneu.

A reveure

Carme SFG

ALARA dijo...

Me gustan, pero aunque nunca me toca nada voy a probar, a ver si esta vez puede ser. Saludos.

Anónimo dijo...

Cuac cuac

Venga, ya que va de cumpleaños yu parafraseando a ese "monstruo", Javier me dice:

Fa vint anys que tinc vint anys (en realidad habría que sumarle el IVA y algunos impuestillos más)
CUACUACUACUACUACUACUACUACUAC
Pato



Chelo dijo...

Hola

Yo también me apunto.

Saludos
Chelo

Véro Q. dijo...

Hola
Vuelvo a apuntarme

Un saludo a todos
Véro

Anónimo dijo...

Saludos a todos. Bueno ya estamos otra vez en el tajo una vez terminadas y exprimidas las "vacas". Por lo que se ve algunos han podido ir nada más y nada menos que a Bora Bora, yo tambien estube a la "vora, vora" de Besalú.
Esperando que hayais tenido unos buenos días en Monzón me voy a dormir.
Salud i sort
Namor

Esperança BCN dijo...

Soposso qu'heureu tingut força diversiò a Monzón....-

Paula dijo...

Bueno, por fin de vacaciones.
Espero que hayáis disfrutado en Monzón y volváis cargados de nuevos marcapáginas. Saludos