17 mar. 2012

SORTEO 33

Poca participación esta semana, por lo que hay más opción de ganar. De todas maneras los conjuros de la bruja son muy potentes y que os voy a decir... le ha tocado a ella, ha salido el número 12 y lo llevaba Emilia.
Para esta semana os he preparado unos marcapáginas de una editorial poco conocida, TRABE por esto los he escogido no por que sean de los más bonitos pero si para darla a conocer.
Espero que os gusten.
Nos encontramos el próximo sábado, venga animaros y poner un comentario.

44 comentarios:

Anónimo dijo...

Home, ja hem tocava ser el primer algun cop.
Felicitats a Emilia.
Be fins demà.
Pere C.

María Rosa dijo...

Me gustan y espero tener suerte. Enhorabuena a Emilia.
Saludos
María Rosa

Anónimo dijo...

No coneixia aquesta editorial. M'agradan.
Sort a tots,
Bartomeu

The Traveler dijo...

Interessant descobrir punts de llibre de noves editorials. M'apunto al sorteig, a veure si hi ha sort.
Albert

Anónimo dijo...

¿Emilia?¿Quien es Emilia?
No la conozco, pero enhorabuena.
Emilia, Emilia, el caso es que me suena...
En cualquier caso, y puesto que las editoriales son mi tema, hablare con la Bruixa para que me prepare un conjuro y poder ganar esta semana.
Abrazos
Javier Aranjuez

Goretti dijo...

No conocía esta editorial, así que me apunto otra semana más

Anónimo dijo...

¡cuac,cuac!
Domenec, no es que haya poca participación, es que somos muy sibaritas y participamos cuando sorteas un pata negra, cuando pones jamon york a la gente como que se le quedan los dedos atrofiados para escribir.
Yo aquí tecleando y vosotros seguro que en Besalú, y la bruixa tambien andará por alli, y mas gente.......
Guardadme un chupito de ratafia.
¡qué envidia!
Alazos Pato

IRATI dijo...

A veure com anirà aquesta setmana la sort.

Salutacions,

IRATI

Anónimo dijo...

Quina sort que te la Bruixa !
Crec que ja és la tercera vegada que li toca !
Al final acabaré creien amb els seus "conjuros"
Felicitats Emilia.
Francesca

Anónimo dijo...

Hola a tots, a veura si tinc sort.
una abraçda
Maite

Anónimo dijo...

Aquesta "BRUIXA" ho acapara tot, felicitats una vegada més.
T'anava a desitjar-te sort,però veig què es de lo què + et sobra,doncs saps que... Millor que m'en desijis una mica de la que et sobra.
Aixó si amb grácies anticipa-des per si...ja.... m'entens.

Salutacións per tot-hom hi a esperar.

Margarita i Josep

Rosa dijo...

Esta semana el sorteo va a estar reñido, estamos a domingo y la participación promete.
Suerte a todos y a todas.
Un saludo.
Rosa.

La Bruixa del punt dijo...

Querido Pato, por una vez tienes razón, acabamos de regresar de la "trobada" de Besalú,ha sido un día magnífico, el tiempo nos ha acompañado, la asistencia ha sido numerosa y con buen potencial, un buen grupo hemos comido juntos con una animada sobremesa terminando el día en una terraza de la plaza con cafeses y otras cosas, como conducimos no hemos tomado ratafía otro día será, terminando la jornada con un paseo por el call judio y unas fotos en le puente, eso tampoco puede faltar.
Marimar animate y veniros una escapa , este mes casi todos los fines de semana en un lugar u otro hay un encuentro.
Escobazos
La Bruixa del punt

Anónimo dijo...

Hola! Yo sé conozco esta editorial pues es de mi tierra y me apunto al concurso porque de todos los que sorteáis sólo tengo uno y los otros ni los conocía. Saludos. Yolanda A.

Anónimo dijo...

Hola, jo tampoc conec aquesta editorial.
Un altra setmana a provar sort.
Salutacions,

Carme

Anónimo dijo...

Hola
Tampoc conec aquesta Editorial.
A veure si tinc sort.
Salutacions.
Roser

Anónimo dijo...

FLASH INFORMATIVO:

ANTE LOS BULOS QUE ESTAN COMENZANDO A CIRCULAR EN ESTE BLOG REFERENTES A PATO, POR LOS(SUSPENDEMOS LA EMISION DE ESTE INFORMATIVO POR CAUSAS AJENAS A NUESTRA VOLUNTAD)
SEGUIREMOS INFORMANDO.
AITOR TILLA.

Anónimo dijo...

RETOMAMOS LA INFORMACION TRAS HABER SIDO REQUERIDO QUIEN LES INFORMA PARA REALIZAR LAS LABORES DOMESTICAS PERTINENTES.
POR CIERTO, SEÑORAS, QUE TAL SE PORTAN LOS CABALLEROS SOBRE ESTE TEMA? AYUDAN O SOLO MUEVEN LOS PUNTS? ADELANTE, PATO PUEDE ESPERAR.

AITOR

mondopunt dijo...

Mi caballero mueve lo que hace falta. La casa y los punts los movemos a partes iguales y... sin requerir a nadie ya que cada uno hace lo que le apetece y te aseguro que la cosa funciona.
Ejem. la limpieza de la cocina és territorio suyo yo sólo entro para cocinar y ensuciar...
Montse

Anónimo dijo...

Montse, detecto un ligero toque de ironia en lo de requerido.......vale.... lo confieso....necesito un leve toque para las tareas domesticas (repito, leve).
Por cierto, la cocina tambien es mi "sancta sanctorum" y me pone de una mala host... que nada más fregarla me la pisen...¿a que sí?.

Saludos. Aitor.

Anónimo dijo...

Cuac, cuac

Este Aitor me consume!!!!!!!!!

Primero con las estampitas y los punts, ahora con el Fairy y el Ariel....

Está más "payá que pacá"

Una cosa ha quedado clara, la mano, además de ser inocente, es "mu apañá".

Alazos. Pato (Collverd)

Anónimo dijo...

Molt animada i amb molt bon temps la trobada de Besalú.
Espero sort amb el sorteig em falten tots
Recordo quan anava a escola i canviava cromos.

Salutacions a tothom

Margarita de Manresa

Anónimo dijo...

Vinga doncs, jo també comento. No tinc cap d'aquestos punts i també m'agradaria guanyar-los.Quan es fa el sorteig? Soc nova en aquesta pagina.
Gemma

Anónimo dijo...

A mi tambien me faltan y la verdad es que son muy bonitos, me apunto y haber si tengo otra vez suerte.
Petonets per tots
Merce C. m-c

Anónimo dijo...

Hola para todos y todas,

Elly

MC col·leccions dijo...

Felicitats Emilia, la sort et somriu i que duri; ah! aveure si entre tots fem venir al Pato,... doncs mira Pato como sabrás este fin de semana si todo va bien en Ripoll estará lleno de coleccionistas, bruixas bruixots y nos gustaria que por nuestros rios (porque sabràs que son dos en uno)se paseara EL GRAN PATO del Tajo (Collverd), a todos nos haría ilusión conoceros...
Salutacions a tots, fins aviat. Miquel i Conxi.

mccp dijo...

A mi tambe mágradaria coneixa el famos pato Cua Cua......Petonets.

JORDI I CARMEN dijo...

SALUDOS A TOTS
Bruixa; donaras cursets de encanteris algun dia? Mi apunto dons veig que funciona tot aixo.
Tornem una mica a la vida a poc a poc.
Mi apunto de nou, per si de cas.
JORDI I CARMEN

Anónimo dijo...

Cuac, Cuac

Aqui Pato desde el correo de Javier.
No perdemos la esperanza de conocer a toda esta gente (Javier diría estupenda, pero como yo no soy Javier -ni quiero serlo- digo que sois cojo...., abreviado porque no sé si estoy en horario infantil).

Un día de estos empujaré a Javier a que cuente a Marimar nuestras andanzas por el blog, y cuando la recuperemos del desmayo, empezaremos a actuar como el agua: poco a poco, sim prisa pero sin pausa......

Alazos. Pato

cosiquina dijo...

No me puedo creer que no los tenga todos. Creo que esta vez sera la buena y me tocaran. Besinos, Inma

Anónimo dijo...

Hola a tots! Una editorial força desconeguda amb uns punts molt interesants. Participo a veure si hi ha sort aquest cop.

Milagros Sauleda

Isabel dijo...

Me apunto. Yo tampoco tengo ninguno de esta editorial.
Saludos

Anónimo dijo...

Hola, a ver si hay suerte esta semana, no tengo ninguno. saludos. MABEL.

Anónimo dijo...

A mi també m´agraden aquests punts !
I parlant de punts......ja només estem a 6 del R.M.
Mercè F.

Anónimo dijo...

Cuac cuac
esa srta Mercè F., ¿no tendrá nada que ver con el arbitraje de ayer ante el submarino amarillo?cuaccccccc,
alazos ( seis, por ahora ) cuaccuaccuaccuaccuac

Teba dijo...

De esta editorial no tengo ninguno! Me apunto!

Anónimo dijo...

Hola a tothom!
No conec l´editorial, i sempre és un bon incentiu ampliar mires narratives i de punts de llibre!

Salutacions!

Glòria (Cardedeu)

La Bruixa del punt dijo...

Mañana en Ripoll 'Fira de les 40 hores' con trobada de punts. Nosotros ya rato que estamos en Queralbs hace un tiempo bueno pero las montañas están blancas. Por cierto en la unión del Ter y el Feser he visto unos patos. Animo al pato del Tajo a probar estas aguas.
La Bruixa del punt

Anónimo dijo...

Cuac,cuac, a ver si alguien se dá por aludido:

¿Vds no hacen reportajes fotográficos de estas Trobadas para luego colgar las fotos en algún Blog con un cartelito que diga: aqui tenemos a Fulano, a Zutano, a Mengano, etc; así, de esta manera, los que no pueden acudir a la trobada, se hacen una idea de cómo ha transcurrido, de cómo son Vds en su salsa.........

¿Me comprenden Vds. o les tengo que hacer un croquis?Venga, pues, ya estamos cargando las cámaras digitales y los móviles, ¿capicci?.

Alazos digitales.

Pato (the Collverd, the One, the Best)

Anónimo dijo...

ULTIMO FLASH INFORMATIVO......POR HOY ¿O PENSABAN QUE SE IBAN A LIBRAR DE MI?

ACABO DE ENTERARME QUE EN LA MADRUGADA DEL SABADO 24 AL DOMINGO 25 DE MARZO HABRÁ QUE ADELANTAR UNA HORA, ES DECIR, A LAS DOS SERAN LAS TRES.

UNA HORITA MENOS DE SUEÑO, PERO, COMO DIRÍA PATO: UNA HORA MENOS PARA GANAR LA LIGA; OTROS PENSARÁN UNA HORA MENOS PARA LLEVARNOS UN BERRINCHE......

EN FIN, QUE EL QUE NO SE CONSUELA ES PORQUE NO QUIERE...

BUEN FIN DE SEMANA

AITOR TILLA

Anónimo dijo...

Con mucha envidia por vuestra trobada
de mañana y suscribiendo la idea de Pato sobre colgar unas fotitos para saber quien es quien, os deseo que lo paseis muy bien y suerte a todos.
Un saludo. Carmen

Anónimo dijo...

buenas noches nosotros tambien nos apuntamos por si la suerte nos toca y los conjuros de la bruixa no hacen sus efectos,felicidades Emilia,desde navarra con cariño para todos Manuel y Mila

Anónimo dijo...

Cuac, Cuac.

Para ser totalmente justo, me comprometo a subir mi foto para que aparezca junto con las del resto de estampilleros, para que las generaciones venideras puedan decir: "¡¡¡Vaya tropa de zumbaos, los unicos que podrían tener un pase son los dos de Aranjuez"!!!

Por cierto, ¿la mano inocente está despierta ya, o como siempre?

Pato

mondopunt dijo...

Vamos por partes, paciencia que la mano inocente recién hemos llegado de Ripoll se ha ido a ver el partido sin pasar por casa, por lo que el sorteo tendrá que esperar.
En cuanto a colgar fotos nuestras de los encuentros lo vamos a valorar pués no queremos que tengáis la excusa de que ya nos conocemos para que no vengáis nunca a un encuentro nuestro.
Por cierto cuac, cuac, hoy NO hemos comido pato, pero tú estás en boca de todos !!!!

Montse