23 dic. 2012

SORTEO 73

! FELIZ  NAVIDAD
De nuevo aquí con todos vosotros a las puertas de estos días tan entrañables, estos días en que se reune toda la familia, estos días de regalos, de comidas, de alegría, etc...
No nos olvidamos del sorteo y de todos vosotros. Ayer fue un día muy feliz para muchos españoles pues el sorteo de la Lotería de Navidad les trajo muchas esperanzas para seguir adelante. Nosotros no tuvimos esta suerte pero nos queda la ilusión y la alegría de estar juntos para vivir día a día.
 
Dos de nuestros amigos recibirán la agradable sorpresa de recibir estos bonitos marcapáginas que nos ofreció SONIA  tan gentilmente. Sonia ya habrás podido comprobar que han gustado mucho y que han sido todo un éxito, espero puedas cambiar con todos estos amigos del blog.
Los afortunados de esta semana han sido : MANEL B. con el número 14 y PATO con el número 17. ¡ ENHORABUENA !
¿Qué os parecen los de esta semana?
Carmen de Salamanca, ¿puedes decirnos cuantos se han editado de estos dos últimos ?
Muchas gracias a todos y... ¡¡¡ a participar !!!!

37 comentarios:

Anónimo dijo...

Hola a tots
primer de tot desitjar que paseu un Bon Nadal a tots.
Aquesta setmana tambe son molt macos, a veura si la sort acompanya.
Maite

Esperança Bcn dijo...

Unes Bones festes de Nadal i cap d'any, i que el que començarà sigui molt millor qu'el mque deixe'm, ( sembla que no costarà gaire.
Els punt s son molt macos, fins un altre.


Esperança BCN

Anónimo dijo...

Molt macos i esperar la sort ja que no n'hi ha hagut per la loteria.

Bones festes i un any nou amb esperança de que tot vagi millor per tothom

Margarita de Manresa

Raquel ♪ dijo...

Enhorabuena a los afortunados.

Me parecen estupendos y quiero participar esta semana. Con el nombre:

Raquel marcando página

Besitos y ante todo felices fiestas... y que paséis unos días muy bonitos junto a la familia.

Anónimo dijo...

Cuac cuac.

¡Enhorabuena a los ganadores, a Manel B. y...¡uy!¡si el otro soy yo, Pato the best!

Perdonadme un momento, ya que lo prometido es deuda....¡Eh, tú, gordinflón vestido de rojo!..¡sí, tú!..¡ya te estás largando con viento fresco que tienes curro pendiente mañana lunes por la noche!¡y límpia las boñigas que han dejado tus renos!¡Qué asco!

Bien, ya estoy aqui.

Pues eso, que me apunto para el nuevo sorteo, que tengais todos unas muy Felices Fiestas y que el próximo año 2013 sea mucho mejor que este.

Alazos de Pato, abrazos de Javier, en cualquier caso, desde el Real Sitio y Villa de Aranjuez.

maribel dijo...

Enhorabona als guanyadors, felicitar també especialment al Pato, crec que s'ho mereix.
M'apunto una setmana més, com sempre, els trobo molt bonics¡
Bon Nadal i bona entrada a l'any nou a tothom¡¡

Rosa. dijo...

Hola.
Los puntos de lectura de esta semana, como siempre, me parecen estupendos.
Felices fiestas a todos y a todas, deseo que el año 2013 se nos presente mejor que el que está finalizando.
Un saludo.
Rosa.

Anónimo dijo...

Una vez mas me apunto al sorteo, esta semana son muy bonitos, como siempre

BON NADAL I FELIÇ ANY 2013

Petonets per tots

Merce C. m-c

Goretti dijo...

¡Habrá que ver si llorando un poco a la mano inocente tengo la suerte del pato y me tocan los marcapáginas!
Saludos

El Útil Marcapáginas dijo...

Los cinco marcapáginas son preciosos.
¡Feliz Navidad!

Josela dijo...

Que bonitos!!!! Me apunto!!!
Feliz Navidad a todos!!!!

Pepi Castellanos dijo...

Hola de nuevo!!!!En primer lugar mi enhorabuena a Manel y a Pato...¡¡¡Pato!!!!!!!!Ahora ¿que tienes que decir??Espero que no te quejes en unas semanas.
Montse, Domènec, seguro que Carmen sabe más de esos mps, yo tengo 5 de ellos, concretamente los que corresponden a las letras R,L,S,U,y F(con lo cuál, ya estoy haciendo conjuros para obtener los otros dos),y que llegaron a mis manos de una forma casual(una señora escuchó a mi hija pedir mps en una librería, se acercó a ella y le ofreció los que tenía pues aunque cogía cuántos se encontraba, no era coleccionista. En mi entrada del blog del 27 de octubre explico lo poco que sé de ellos.

Espero tener suerte. Feliz Navidad a todos.

Pepi

JORDI I CARMEN dijo...

Hola a tothom.
Felicitar als guanyadors (inclos el PATO). Tambe les festes Nadalesques i de l'any vinen.
Per el que es ve-ho son lletres i seria llogic que fosin totes, ja que semble que en tenim com a minim 7.
La sort alguna vegada a de venir a Les Corts.
JORDI

Sonia Andrade Lee dijo...

FELICIDADES a los GANADORES!!

Pato, cuanto me alegro que ganaras!! De paso ya puedes ir soltando al panzón vestido de rojo para que llegue a tiempo a sus quehaceres...

Hoy ya me apunto para este sorteo, tal vez tengo suerte de fin de año!

Un abrazo y MUY FELIZ NAVIDAD a TODOS!!

Anónimo dijo...

Cuac Cuac,S.Andra D. (mi Sandy de Grease).

Reina, ya lo solté en mi comentario de arriba.

¡¡¡ESPERO QUE NO ME CULPES SI NO RECIBES TUS REGALOS; ESO SERÁ QUE NO TE LOS MERECES!!
(cuacuacuacuacuacuacuacuacuacuac)

Anónimo dijo...

Cuac Cuac.

Permitidme que os ponga la letra de una preciosa canción de Raphael (leedla con atencion, dice verdades como puños)

Navidad
un cucurucho lleno de castañas
Navidad
noche de besos de tela de araña
Navidad
la abuela con su toca azul marino
Navidad
las casas aromadas con roscos de vino
Navidad
las sillas puestas de los que cayeron
Navidad
raíces para los nuevos viajeros
Navidad
figuras de un portal siempre más viejo
Navidad
silencio al dar las doce ante el espejo.

Si no fuera por las luces de neón, y los recuerdos que rescatan mi ilusión, no habría diciembres para pensar en tí
Y si no fuera por la escarcha de papel,por esa estrella y ese Niño de Belén no habría motivos para brindar por tí,

Maldita y Bendita Navidad
Bendita y Maldita Navidad
con su eterna canción:
un año sin amor
y un día para amar.

Navidad
Jerusalem envuelta en puras llamas
Navidad
ni sana hoy ni sanará mañana
Navidad
Adan matando siempre a Eva
Navidad
de niños que no tienen quien les quiera
Navidad
la guerra santa, guerra por dinero
Navidad
pateras llenas de angelitos negros
Navidad
la calle el reino de los sin papeles
Navidad
de los sin techo buscando pesebres

Si no fuera por las luces de neón
por los recuerdos que rescatan mi ilusión,no habría diciembres para pensar en tí.
Y si no fuera por la escarcha de papel,por esa estrella y ese Niño de Belén no habría motivos para brindar por tí.

Bendita y Maldita Navidad
Maldita y Bendita Navidad
con su eterna canción
un año sin amor
y un día para amar.

Navidad
aquí acaba por hoy el cancionero
Navidad
mañana volverá el tamborilero.


Alazos de verdad con mucho cariño.
Pato

Anónimo dijo...

Aquests punts són preciosos, a veure si tenim sort.
Bon Nadal a tots.

Salutacions des de Solsona. Montse S.

Véro Q. dijo...

Muy bonitos.
Feliz Navidad a todos.

Véro Q.

Anónimo dijo...

Felices Fiestas para todos y que el año que viene nos traiga salud, felicidad y puntos para compartir.

Abrazos desde Holanda

Elly y Ger

Amaia Villa dijo...

Hola Amaia y escribo poesía . También tengo un blog y te invito a participar en un SORTEO DE UNA COLECCIÓN DE MARCAPAGINAS ORIGINALES diseñados por mi, con mis poemas y los cuadros de una amiga pintora. Te invito a que entres y partícipes amaiavillaescritura.blogspot.com.es/ ¡feliz Navidad!

irati dijo...

Enhorabona als guanyadors !!!
Els punts de les lletres són molt macos.
¡FELIÇ ANY NOU 2013!

Isabel dijo...

Feliz Navidad a tod@s!

Anónimo dijo...

Hola, Felices Pascual y buen 2013 os deseo. MABEL.

Anónimo dijo...

Hola.
Yo tengo algún marcapáginas de la feria del libro de Salamanca, pero no son estos. La verdad es que cuidan mucho la presentación, porque son preciosos.
Feliz año nuevo.
Un saludo desde Plasencia.
Gloria.

Anónimo dijo...

Ja he deixat enrera la ressaca de Nadal i per no perdre el costum m'apunto al sorteig, a veure si al ser l'últim de l'any tenim sort.
Aprofito també per desitjar un Feliç any Nou a tots¡¡.

Manel G.B.
Castellfollit

gran galvez dijo...


no YA manera ?

Anna dijo...

Com sempre els punts que sortegeu són molt bonics.
Bones Festes!
Salutacions des de Montblanc
Anna

Cle dijo...

La enhorabona als dos guanyadors!!
I ara a participar al sorteig setmanal que com de costum hi oferiu uns punts molt bonics.
Feliç Any Nou 2013!!

Salutacions,
Cle per Jana

Justa dijo...

Envidiosas enhorabuenas a Manel B. y a.........¡¡¡¡Pato Mesetero!!! (no dirás que últimamente no te visita la suerte, ya que creo recordar que también te tocó el sorteo de Eli ¿no?
Los marcapáginas de esta semana son muy bonitos. Sabía de la existencia de los últimos por una entrada de Pepi de "Arte entre páginas".
Un abrazo

Justa

Anónimo dijo...

BONES FESTES NADALENQUES.

Heu vist l'Estrella ?
Heu vist els Reis ?
Cada any més bella
Cada any més vells

Siguem estrella
sempre tot l'any
per du alegria
a un company

Heu vis l'estrella!
Heu vist els reis!
Cada any més BELLA
Cada any més VELLS

Salutacions a tots

Feliç Any Nou i conque acaba amb
tres ja ho veureu, no pasara RES...

Margarita i josep

Anónimo dijo...

Hola
L`ultim sorteig de l`any ....
Bé a participar doncs toca per si la sort em vol fer més que contenta
però ho dubto...però he de tentar-la .....
MOLT BON FI D´ANY i MILLOR ANY 2013
PER A TOTHOM!!!
Salutacions.
Roser

Anónimo dijo...

El último sorteo del año, a ver si tengo suerte.
Referente al punto de la letra de Salamanca, creo que editaron el abecedario completo con motivo de ser la Capital de la Cultura pero los daban en diferentes lugares y se agotaron, nosotros fuimos al año siguiente y localizamos unos pocos pero imposible completarlos.
Felicidades a los ganadores de la semana pasada y nuestros deseos de prosperidad en el 2013 para todos.
La Bruixa del punt

Anónimo dijo...

Moooolt bon any a tothom!!!
Que sigui un any ple de llum, salut i llibertat!

I provo sort altra vegada...a veure si l´últim de l´any...

Glòria de Cardedeu

Anónimo dijo...

Hola, a tod@s

Muchas gracias Montse y Domènec, la suerte me ha sonreido otra vez inesperadamente. El año ha sido difícil y con vosotros y el buen rollo que se respira aquí termino con una sonrisa.
Lo mejor para todos en el nuevo año.
Esta semana no participo.

Saludos

Manel B.

Anónimo dijo...

Lo primero felicidades a Manel y a Pato. Despues deciros que de los mps
del abecedario no tengo ni idea, solo llevo un año coleccionando y no los conocía, pero prometo investigar. Suerte a todos y Feliz 2013.
Carmen (Salamanca)

Anónimo dijo...

El año 2012 se términa y desde aquí felicitar a todos el nuevo año.
Salud,suerte y muchos puntos.
Namor.

Anónimo dijo...

After getting more than 10000 visitors/day to my website I thought your mondopunts.blogspot.com website also need unstoppable flow of traffic...

Use this BRAND NEW software and get all the traffic for your website you will ever need ...

= = > > http://get-massive-autopilot-traffic.com

In testing phase it generated 867,981 visitors and $540,340.

Then another $86,299.13 in 90 days to be exact. That's $958.88 a
day!!

And all it took was 10 minutes to set up and run.

But how does it work??

You just configure the system, click the mouse button a few
times, activate the software, copy and paste a few links and
you're done!!

Click the link BELOW as you're about to witness a software that
could be a MAJOR turning point to your success.

= = > > http://get-massive-autopilot-traffic.com